Thursday, August 11, 2022
No menu items!
HomeBiologyThe polyol pathway is an evolutionarily conserved system for sensing glucose uptake

The polyol pathway is an evolutionarily conserved system for sensing glucose uptake

[ad_1]

Introduction

The correct sensing of ingested vitamins is important for organismal survival. Animals must sense quantitative and temporal adjustments of their dietary standing because of day by day feeding to optimize metabolism. Glucose is probably the most generally used power supply for animals and gives an excellent instance of how they developed programs that obtain dietary adaptation. Ingestion of glucose induces dietary adaptation within the type of will increase in glucose absorption and metabolism in addition to lipogenesis to retailer extra vitamins, and insufficient adaptation would possibly contribute to metabolic ailments corresponding to weight problems and kind 2 diabetes. Glucose-dependent transcription is a crucial mechanism of glucose-induced dietary adaptation [1], and such metabolic reworking largely depends on a grasp transcription issue, carbohydrate responsive ingredient binding protein (ChREBP) [2]. ChREBP prompts the expression of glycolytic and lipogenic genes with their obligated associate, max-like protein X (Mlx), thereby storing extra vitamins within the type of lipids within the liver and adipose tissues [3]. MondoA, a paralog of ChREBP, features within the skeletal muscle [4]. In Drosophila, the homologue of ChREBP/MondoA is encoded by a single gene, Mondo. Transcriptome evaluation has proven that the Mondo-Mlx (additionally known as Bigmax in Drosophila) complicated induces world adjustments in metabolic gene expression in response to sugar uptake [5,6]. To attain a metabolic shift, info on glucose availability should in some way be transmitted to ChREBP/MondoA.

Upon glucose uptake, ChREBP/MondoA is translocated to the nucleus, which is a pivotal step for ChREBP/MondoA activation. ChREBP/MondoA shuttles between cytoplasmic and nuclear compartments and is primarily localized on the cytoplasm within the basal state [4,7,8]. Glucose stimuli shift ChREBP/MondoA to the nuclei by means of the N-terminal area containing a nuclear localization sign [9,10]. In parallel with this, derepression of transcriptional activation area happens and transcriptional exercise is exerted. Though the exact mechanism is unknown, it has been thought that metabolites generated from glucose immediately or not directly regulate the nuclear localization of ChREBP/MondoA.

Utilizing nuclear translocation and transcriptional activation as indicators, ChREBP/MondoA-activating sugars have been explored by administering candidate sugars to cultured cells. Thus far, a number of candidates corresponding to xylulose 5-phosphate, glucose-6-phosphate, and fructose-2,6-bisphosphate have been recognized [1119]. These sugars are synthesized by means of both glycolysis or the pentose phosphate pathway (PPP) that branches off from glycolysis. Thus, cells had been thought to detect blood glucose ranges by assessing the actions of those 2 pathways. Nonetheless, the degrees of metabolites in these pathways stay principally fixed after glucose uptake partly as a result of storage sugars [20]. Storage sugars corresponding to glycogen are recognized to supply buffering motion to forestall drastic adjustments in glucose metabolism; extreme nutrient uptake promotes the conversion of glucose-6-phosphate into glycogen, whereas hunger induces the breakdown of glycogen into glucose-6-phosphate. Furthermore, glycolysis is tightly regulated by suggestions management; glycolytic enzymes, together with hexokinase working on the most upstream level within the pathway, are activated or inhibited by downstream metabolites [21]. Subsequently, glycolysis and PPP are prone to be insufficient as real-time sensors to detect small adjustments in glucose focus beneath regular physiological situations. These findings counsel that the activation of ChREBP/MondoA includes a hitherto unrecognized pathway.

On this examine, we present that the polyol pathway is concerned within the activation of Mondo/ChREBP. The polyol pathway is a 2-step metabolic pathway, through which glucose is decreased to sorbitol then transformed to fructose [22]. Though physiological features of this pathway stay elusive, the genes encoding polyol pathway enzymes are conserved from yeasts to people, suggesting that it performs an necessary as but unknown position throughout species. We exhibit that the polyol pathway metabolites promote, and its mutations disturb nuclear translocation of Drosophila Mondo. The polyol pathway regulates Mondo/Mlx-target metabolic genes, resulting in correct development and physiology of Drosophila larvae. We additional present that this pathway is required for glucose-responsive nuclear localization of ChREBP in hepatocytes and glucose tolerance in mice. Our outcomes present that the polyol pathway is an evolutionarily conserved system for sensing glucose uptake that enables metabolic reworking.

Outcomes

Sorbitol feeding induces Mondo-mediated CCHa2 expression

As a marker to evaluate what would possibly activate Mondo/ChREBP, we selected a glucose-responsive hormone, CCHamide-2 (CCHa2). CCHa2 has been instructed to be a goal of Mondo, a Drosophila homologue of ChREBP/MondoA [6]. CCHa2 is synthesized primarily within the fats physique, an organ analogous to the mammalian liver and adipose tissues, in response to glucose ingestion [23]. The fats physique is the prime organ of Mondo motion as Mondo mutant phenotype may be largely rescued by restoring Mondo solely within the fats physique [5]. To look at whether or not Mondo prompts CCHa2 expression within the fats physique, we knocked down Mondo particularly within the fats physique. The knockdown decreased the expression of CCHa2 beneath common tradition situations (Fig 1A). It additionally decreased CCHa2 expression upon glucose refeeding after 18-hour hunger, indicating that Mondo is required for acute induction of CCHa2 expression in response to glucose ingestion (Fig 1B). This tissue-autonomous regulation by Mondo makes CCHa2 a wonderful marker for analyzing how sugars activate Mondo.

thumbnail

Fig 1. Sorbitol feeding induces Mondo-mediated CCHa2 expression.

(A) CCHa2 mRNA ranges in third instar larvae (72 hours AEL) through which Mondo was knocked down within the fats physique utilizing the Cg-GAL4 driver. (B) Mondo-knockdown larvae had been starved for 18 hours then refed with 10% glucose for six hours. CCHa2 mRNA ranges had been quantified after refeeding. (C) Results of various sugars on CCHa2 expression. Starved wild-type larvae had been refed for six hours with a ten% resolution of the indicated sugars. (D) The polyol pathway. (E) The share of polyol pathway metabolites derived from 13C6-labeled ingested glucose (M+6) and endogenous unlabeled glucose (M+0). (F) Starved wild-type larvae had been refed for six hours with a ten% resolution of the indicated sugars; 10 larvae per batch, n = 3 batches. Bar graphs present imply ± SE. n.s. P > 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001 (A–C and F); 3 larvae per batch, n = 6 batches. The bar graph reveals imply ± SD (E). The info underlying the graphs may be present in S1 Knowledge. AEL, after egg laying; AR, aldose reductase; Sodh, sorbitol dehydrogenase.


https://doi.org/10.1371/journal.pbio.3001678.g001

To determine metabolic pathways required for CCHa2 expression, we examined the consequences of sugars on CCHa2 expression. We starved Drosophila larvae for 18 hours then refed them with a number of sugars. Along with glucose and fructose [23,24], sorbitol was discovered to be able to inducing CCHa2 expression (Fig 1C). As a result of sorbitol is generated and metabolized solely by the polyol pathway [the Kyoto Encyclopedia of Genes and Genomics (KEGG) pathway database] [2527], the induction of CCHa2 expression doubtless includes metabolic reactions by means of the polyol pathway. On this pathway, glucose is transformed to sorbitol by aldose reductase (AR, EC: 1.1.1.21), after which to fructose by sorbitol dehydrogenase (Sodh, EC: 1.1.1.14) (Fig 1D) [2527]. It has been proven that the quantity of sorbitol and fructose correlates with the quantity of glucose in diets [28], and we exhibit that sorbitol and fructose are synthesized from 13C-labeled ingested glucose (Fig 1E). These information point out that the polyol pathway is functioning in Drosophila. Whereas AR and Sodh are additionally predicted to rework xylose to xylulose by way of xylitol (the KEGG pathway database) [2527], xylitol didn’t induce CCHa2 expression considerably in wild-type larvae (Fig 1F). We thus reasoned that the position of the polyol pathway may be revealed by analyzing the requirement of AR and Sodh.

The polyol pathway is required for correct larval development and physiology

To create genetic instruments to dam the polyol pathway, we doubly mutated the putative AR genes, CG6084 and CG10638, hereafter named AR mutants (S1and S2 Figs). We additionally mutated sorbitol dehydrogenase (Sodh) genes, Sodh-1 and Sodh-2, creating what we hereafter consult with as Sodh mutants (S3 Fig). Each AR and Sodh mutants confirmed metabolic phenotypes as predicted: Ranges of sorbitol within the hemolymph had been decreased in AR mutants and had been elevated in Sodh mutants (S4 Fig). Utilizing the mutants, we examined whether or not the polyol pathway has any physiological perform in Drosophila larvae. When mutant larvae had been raised on a traditional eating regimen, AR and Sodh mutant larvae displayed a slight lower in development price throughout larval levels, and important pupation defects (S5A–S5C Fig) whereas the quantity of mutant pupae and the physique weight of mutant adults had been indistinguishable from these of management animals (S5D and S5E Fig). Since mlx mutants have proven to be deadly on a protein-rich eating regimen [5], we examined phenotypes of AR and Sodh mutants beneath the identical tradition situation. The mutant larvae confirmed a marked discount in development price throughout larval levels, with solely a small variety of larvae changing into pupae (Fig 2A and 2B). To look at whether or not the expansion defects are because of down-regulation of Drosophila insulin-like peptides (Dilps), we measured dilp mRNA ranges and Dilp secretion in larvae at 96 hours after egg laying (AEL). dilp5 mRNA ranges had been decreased in AR and Sodh mutants (Fig 2C). dilp2 mRNA ranges had been elevated (Fig 2D) and its secretion appeared regular as few Dilp2 indicators remained in insulin-producing cells in mutants (Fig 2E–2H). We detected elevated expression of Insulin-like receptor (InR) and Thor encoding Drosophila homologue of the initiation issue 4E-binding protein (4EBP), that are indicators of insulin resistance [29], in AR mutants (Fig 2I and 2J). Subsequently, elevated dilp2 expression might be as a result of growth of insulin resistance, and insulin resistance can also contribute to development defects in mutants. The polyol pathway mutants exhibited a lower in complete larval triglycerides, and irregular hemolymph glucose ranges on a protein-rich eating regimen (Fig 2K–2P). The phenotypic distinction between AR and Sodh mutants is probably going attributable to AR’s involvement in metabolic pathways aside from the polyol pathway [2527]. These metabolic phenotypes and development defects had been partially restored by the overexpression of Mondo within the fats physique (Fig 2K–2P). It’s unlikely that the rescue was incomplete as a result of involvement of different tissues as the ever-present expression of Mondo didn’t considerably enhance the rescue (S6 Fig).

thumbnail

Fig 2. The polyol pathway is required for correct larval development and physiology.

(A) Larval physique weight of AR and Sodh mutants reared on protein-rich diets; 10–50 animals per batch, n = 3 batches. The road graph reveals imply ± SE. (B) Timing of pupal formation in AR and Sodh mutants. Thirty larvae had been grown per vial and pupation was scored each 24 hours. n = 3 vials. The road graph reveals imply ± SE. (C–H) Expression and secretion of Dilps in AR and Sodh mutant larvae. dilp5 and dilp2 mRNA ranges had been measured by RT-qPCR; 10 larvae per batch, n = 3 batches. Bar graphs present imply ± SE (C and D). Dilp2 was detected by anti-Dilp2 antibody (magenta), and insulin-producing cells had been labeled by dilp2>mCD8::GFP (inexperienced) (E and G). Single-channel pictures of the Dilp2 indicators are proven in F and H. Scale bar represents 10 μm. (I, J) InR and Thor mRNA ranges had been measured by RT-qPCR. (Okay–P) Physique weight, complete physique triglyceride, and hemolymph glucose ranges in larvae of management, AR mutant, AR mutant with Mondo overexpression within the fats physique (AR, fb>Mondo) (Okay–M), and management, Sodh mutant, Sodh mutant with Mondo overexpression within the fats physique (Sodh, fb>Mondo) (N–P); 5–10 larvae per batch, n = 3 batches. Bar graphs present imply ± SE. *P < 0.05; ***P < 0.001; ****P < 0.0001. The info underlying the graphs may be present in S1 Knowledge. AR, aldose reductase; Dilps, Drosophila insulin-like peptide; RT-qPCR, reverse transcription quantitative PCR; Sodh, sorbitol dehydrogenase.


https://doi.org/10.1371/journal.pbio.3001678.g002

The polyol pathway can mediate sugar-induced transcriptional alteration of Mondo/Mlx-target genes

The phenotypes of AR and Sodh mutants counsel that the polyol pathway regulates not solely CCHa2 but additionally a variety of Mondo/Mlx-target genes. We thus examined whether or not the polyol pathway {couples} glucose ingestion to world transcriptional alteration by means of Mondo. Starved larvae had been refed with both glucose or sorbitol, and expression ranges of sugar-responsive Mondo/Mlx-target genes [6] (S2 Knowledge) had been quantified by RNA-seq evaluation. On condition that sorbitol is metabolized solely by means of the polyol pathway, metabolites generated by the polyol pathway can be selectively elevated in sorbitol-fed larvae, whereas metabolites of polyol, glycolytic, and PPP pathways can be elevated in glucose-fed larvae. We detected a powerful correlation between the adjustments induced by glucose and sorbitol (Fig 3A). Transcriptome adjustments upon sorbitol feeding had been misplaced within the Sodh mutants (Fig 3B), confirming that sorbitol-induced gene regulation noticed in wild sort relies on the polyol pathway. Fructose, the top product of the polyol pathway, restored gene regulation within the Sodh mutants (examine Fig 3C and 3D), though the likelihood that the inflow of fructose into glycolysis participates within the rescue can’t formally be dominated out. These outcomes present that the polyol pathway can regulate the expression of Mondo/Mlx-target genes.

thumbnail

Fig 3. The polyol pathway can mediate sugar-induced transcriptional alteration of Mondo/Mlx-target genes.

(A–D) Wild-type and Sodh mutant third instar larvae had been starved for 18 hours, adopted by refeeding for six hours with a ten% resolution of indicated sugars. A comparability of expression adjustments of the Mondo/Mlx-target genes between glucose-fed and sorbitol-fed wild-type larvae (A), sorbitol-fed wild-type and Sodh mutant larvae (B), glucose-fed wild-type and sorbitol-fed Sodh mutant larvae (C), glucose-fed wild-type and fructose-fed Sodh mutant larvae (D). (E) The expression adjustments of metabolic genes. Genotype of larvae and fed sugars are indicated above. Identified Mondo/Mlx-target genes are indicated in purple (activated genes) or inexperienced (suppressed genes). (F) A comparability of expression adjustments of the Mondo/Mlx-target genes between glucose-fed wild-type and Sodh mutant larvae; 30 larvae per batch, n = 3 batches. Correlation coefficients (r) are indicated within the plots (A–D and F). (G) Results of various sugars on CCHa2 expression in Sodh mutant larvae. (H) CCHa2 mRNA ranges within the third instar larvae of polyol pathway mutants raised on a traditional eating regimen containing 10% glucose; 10 larvae per batch, n = 3 batches. Bar graphs present imply ± SE. n.s. P > 0.05; ***P < 0.001; ****P < 0.0001. The info underlying the graphs may be present in S1 Knowledge and S3S8 Knowledge. AR, aldose reductase; Sodh, sorbitol dehydrogenase.


https://doi.org/10.1371/journal.pbio.3001678.g003

We then examined whether or not the polyol pathway triggers Mondo/Mlx-mediated metabolic reworking. We targeted on genes encoding enzymes concerned in glycolysis/gluconeogenesis, PPP, fatty acid biosynthesis, and glutamate and serine metabolism, a lot of that are beneath the management of Mondo/Mlx [6]. We noticed comparable expression patterns of those metabolic genes when wild-type larvae had been fed with glucose or sorbitol (Fig 3E). Modifications in metabolic gene expression had been decreased in sorbitol-fed Sodh mutant larvae, however had been restored in Sodh mutant larvae when fructose was fed. Particularly, the degrees of recognized Mondo/Mlx-target genes had been remarkably restored (indicated in purple or inexperienced in Fig 3E). These outcomes present that the polyol pathway can induce the expression of assorted metabolic enzymes, resulting in a metabolic reworking in response to sugar ingestion. Nonetheless, when starved Sodh mutant animals had been fed with glucose, a substantial variety of Mondo/Mlx-target genes together with CCHa2 had been regulated correctly (Fig 3E–3G). These outcomes counsel that glucose-metabolizing pathways aside from the polyol pathway can activate Mondo beneath starved situations. In distinction, CCHa2 expression was considerably decreased in AR and Sodh mutant larvae beneath regular feeding situations with common fly meals containing 10% glucose (Fig 3H). These outcomes counsel that the polyol pathway has differential necessities in several dietary situations; it’s dispensable for Mondo/Mlx-mediated gene expression when glucose is supplied after hunger however is required beneath regular dietary situations.

The polyol pathway regulates nuclear localization of mondo

The above outcomes counsel that the polyol pathway is concerned in a vital step within the activation of Mondo beneath regular physiological situations. Subsequently, we examined the consequences of polyol pathway mutations on nuclear localization of Mondo. We tagged endogenous Mondo with the Venus fluorescent protein (S7 Fig), and noticed intracellular localization of the Mondo::Venus fusion protein beneath fed and starved situations. We first examined Mondo::Venus localization in fats our bodies dissected from usually fed third instar larvae. We utilized ex vivo tradition of fats our bodies to reduce the consequences of feeding situations between larvae. It has been reported that mammalian ChREBP/MondoA shows nuclear localization when glucose concentrations are elevated 5- to 10-fold [8,1012,17,19,30,31]. Subsequently, we in contrast the nuclear localization of the Mondo::Venus protein in fats our bodies cultured in Schneider’s Drosophila medium (hereafter known as the essential medium) that accommodates 11 mM glucose and people cultured in the identical medium supplemented with 55 mM sugars. Within the fundamental medium, 5.2% of Mondo::Venus indicators had been localized within the nuclei of wild-type fats physique cells (Fig 4A and 4B). When glucose, sorbitol, or fructose had been added to the essential medium, the share of nuclear Mondo::Venus indicators was elevated to 14.6%, 12.7%, and 16.7%, respectively (Fig 4A and 4B). In distinction, within the AR mutant or Sodh mutant fats physique cells, glucose administration didn’t improve nuclear Mondo::Venus indicators, suggesting that the polyol pathway required for the activation of Mondo (Fig 4A, 4C and 4D). Certainly, metabolites generated within the polyol pathway bypassed the necessities for AR or Sodh within the nuclear localization of Mondo (Fig 4A, 4C and 4D). These outcomes point out that the polyol pathway regulates the exercise of Mondo by selling its nuclear localization. To look at the localization of Mondo::Venus beneath starved situations, larvae had been starved for 18 hours then refed with glucose. The assay was carried out at 1 hour after feeding, when the gut was full of sugar in most larvae. In distinction to the ends in fats our bodies from usually fed larvae, Mondo::Venus was translocated to the nucleus on the addition of glucose in AR and Sodh mutant fats physique cells (Fig 4E–4H). These outcomes are per the conclusion from the gene expression evaluation that the polyol pathway is dispensable for Mondo’s perform when glucose is supplied after hunger however is required beneath regular dietary situations.

thumbnail

Fig 4. The polyol pathway regulates nuclear localization of Mondo.

(A) Fats our bodies dissected from usually fed Mondo::Venus knockin larvae had been cultured in Schneider’s Drosophila medium supplemented with 55 mM glucose, sorbitol, or fructose for quarter-hour. After tradition, the fats our bodies had been mounted and stained with the next markers: anti-GFP antibody for Mondo::Venus (inexperienced), DAPI (magenta), and Rhodamine-conjugated phalloidin (blue). Single-channel pictures of the Venus indicators are proven, with nuclei indicated by arrowheads. (B–D) The share of nuclear Mondo::Venus sign out of the entire Mondo::Venus sign in a cell was quantified within the pictures. Stable and dotted traces within the graph present the median and quartiles, respectively. Pictures of 49 to 56 fats physique cells per experiment had been quantified. (E) Mondo::Venus larvae had been starved for 18 hours then refed with 10% glucose for 1 hour. The localization of Mondo::Venus within the fats physique cells was detected by Venus fluorescence (inexperienced), and nuclei had been labeled with DAPI (magenta). Single-channel pictures of the Venus indicators are proven, with nuclei indicated by arrowheads. Scale bar represents 50 μm. (F–H) The ratio of common depth of Mondo::Venus indicators detected within the nucleus and cytoplasm in fats physique cells. Stable and dotted traces within the graph present the median and quartiles, respectively. Pictures of 203 to 332 fats physique cells per experiment had been quantified. Scale bars in (A) and (E) signify 50 μm. *P < 0.05; ****P < 0.0001. The info underlying the graphs may be present in S1 Knowledge. AR, aldose reductase; Sodh, sorbitol dehydrogenase.


https://doi.org/10.1371/journal.pbio.3001678.g004

The polyol pathway features as a glucose-sensing system in mouse liver

To make clear whether or not the perform of the polyol pathway within the sensing of glucose uptake is evolutionarily conserved, we knockout the Sorbitol dehydrogenase (Sord) gene, the one gene encoding Sorbitol dehydrogenase in mice (S8A Fig). Sord knockout mice confirmed regular development and feeding (Fig 5A and 5B). We investigated the nuclear localization of ChREBP in response to sugar ingestion within the liver of wild-type and Sord knockout mice. To take away ChREBP from the nuclei of the hepatocytes, we starved mice in a single day. We orally administered sugar resolution to starved mice and examined the intracellular localization of ChREBP in hepatocytes. We targeted on pericentral hepatocytes (S8B Fig) as Sord is preferentially expressed [32,33]. Glucose or fructose ingestion promoted nuclear localization of ChREBP in wild-type mice (Fig 5C–5E, 5I–5K and 5O). In Sord knockout mice, glucose administration didn’t promote nuclear translocation of ChREBP (Fig 5F, 5G, 5L, 5M and 5O), whereas fructose ingestion did (Fig 5H, 5N and 5O). We then examined the metabolic phenotype of Sord knockout mice. They displayed comparable phenotypes to these of ChREBP knockout mice: regular hepatic lipid accumulation (Fig 5P) and a delay within the restoration of blood glucose ranges after oral glucose administration (Fig 5Q and 5R). Serum insulin ranges had been comparable in wild-type and Sord knockout mice (Fig 5S). Subsequently, noticed glucose intolerance could also be because of decreased insulin sensitivity, as in ChREBP knockout mice [3,34]. These outcomes point out that the polyol pathway has an necessary perform in sensing glucose uptake in mouse liver, and its deficiency results in impaired glucose tolerance. Thus, the polyol pathway is a typical system for sensing glucose uptake in flies and mouse.

thumbnail

Fig 5. The polyol pathway regulates nuclear localization of ChREBP in hepatocytes and glucose tolerance in mice.

(A, B) Physique weight (A) and cumulative power consumption in management and Sord KO mice (B) had been measured for 14 weeks. n = 4 for management, n = 4 for Sord KO. (C–N) Water (DW), glucose, or fructose had been administered orally to starved management and Sord KO mice, and the localization of ChREBP within the hepatocytes was examined quarter-hour after administration. Liver slices had been stained with the next markers: anti-ChREBP antibody (purple), anti-CYP3A4 for pericentral hepatocytes (inexperienced), and DAPI for nuclei (blue). Scale bar represents 30 μm. (O) The ratio of common depth of ChREBP indicators detected within the nucleus and cytoplasm within the pericentral hepatocytes. Stable and dotted traces within the graph present the median and quartiles, respectively. Pictures of 539 to 910 hepatocytes per experiment had been quantified. n = 3 animals per experiment. (P) The quantity of hepatic triglyceride was quantified in management and Sord KO mice. (Q) Blood glucose ranges had been measured over a 90-minute interval after glucose administration. (R) AUC was calculated relative to the quick blood glucose concentrations. n = 4 for management, n = 10 for Sord KO. (S) Plasma insulin ranges had been measured earlier than and quarter-hour after glucose administration. n = 6 for management, n = 5 for Sord KO. All experiments had been carried out utilizing male mice. *P < 0.05; **P < 0.01; ****P < 0.0001. The info underlying the graphs may be present in S1 Knowledge. AUC, space beneath the curve; ChREBP, carbohydrate responsive ingredient binding protein; KO, knockout.


https://doi.org/10.1371/journal.pbio.3001678.g005

Dialogue

It has lengthy been believed that the polyol pathway is sort of silent, because the affinity of AR for glucose may be very low in comparison with that of hexokinase for glucose. This pathway is regarded as activated solely beneath hyperglycemic situations, resulting in diabetic issues [35]. Nonetheless, genome analysis has revealed that genes encoding enzymes of the polyol pathway are conserved from yeasts to people, suggesting that this pathway is necessary throughout species [2527]. On this examine, we revealed an evolutionarily conserved perform of the polyol pathway in glucose sensing and organismal physiology.

The importance of the polyol pathway in glucose sensing

To allow correct organismal adaptation to ingested glucose, the exercise of the metabolic pathway(s) required for glucose sensing is anticipated to correlate with the degrees of glucose within the physique fluid. The polyol pathway seems to satisfy these situations. First, the polyol pathway metabolizes glucose instantly after it enters the cell (Fig 6A) [2527]. Second, the polyol pathway can be much less affected by storage sugars. Glycogen, the key carbohydrate storage type in animal cells, is transformed reversibly into glucose-6-phosphate based on nutrient standing of the cell (Fig 6A). The changes to totally different dietary states preserve fixed glucose-6-phosphate ranges, thereby aiding the steadiness of glycolysis and PPP whatever the availability of glucose [20]. Third, no suggestions management on the polyol pathway has been reported. This can be a sharp distinction to glycolysis, through which a number of enzymes are topic to suggestions management by downstream metabolites. Hexokinase appearing on the most upstream level in glycolysis is tightly regulated by its product [21]. Phosphofructokinase 1, a rate-limiting enzyme of glycolysis, can also be managed by a number of downstream metabolites corresponding to ATP, AMP, citrate, lactate, and fructose-2,6-bisphosphate [36]. These observations counsel that the polyol pathway might exhibit a linear response to glucose ranges within the physique fluid higher than glycolysis and PPP beneath regular feeding situations. Subsequently, it’s conceivable that the polyol pathway acts as a glucose-sensing system beneath situations through which homeostasis of main glucose metabolic pathways is maintained by storage sugars and suggestions management. Our outcomes additionally present that the polyol pathway is dispensable for Mondo/Mlx-mediated gene expression and nuclear translocation of Mondo when the larvae had been refed with glucose after 18-hour hunger (Figs 3E–3G and 4E–4H), through which glycogen is totally consumed within the fats physique [37]. In such scenario, the exercise of glycolysis and PPP might additionally replicate glucose uptake and performance as a glucose sensor resulting in Mondo activation. The existence of a number of glucose-sensing pathways may be associated to the identification of glycolytic and PPP-derived metabolites as Mondo/ChREBP-activating sugars in mammalian cell tradition programs (Fig 6A). Having varied glucose-sensing programs can be helpful for cells and organisms for his or her adaptation to several types of adjustments in dietary situations.

thumbnail

Fig 6. The position of the polyol pathway.

(A) Metabolic pathways resulting in Mondo/ChREBP activation. Glucose-6-phosphate (Glucose-6-P), xylulose-5-phosphate (Xu-5-P), and fructose 2,6-bisphosphate (Fructose-2,6-BP) had been recognized beforehand as Mondo/ChREBP-activating metabolites in mammalian cell tradition programs (grey arrows) [2]. These metabolites are generated in glycolysis (blue arrows) or PPP (inexperienced arrow). Our examine revealed that the polyol pathway (magenta arrows) has a big contribution to activating Mondo/ChREBP in flies and mice (magenta arrows). (B) Physiological roles of the polyol pathway. The polyol pathway screens glucose ranges and regulates Mondo/ChREBP accordingly. This method permits animals to regulate metabolic actions to glucose availability and carry out correct physiological features. AR, aldose reductase; ChREBP, carbohydrate responsive ingredient binding protein; HK, hexokinase; Mlx, max-like protein X; PFK1, phosphofructokinase 1; PFK2, phosphofructokinase 2; PPP, pentose phosphate pathway; Sodh, sorbitol dehydrogenase.


https://doi.org/10.1371/journal.pbio.3001678.g006

Our outcomes counsel that fructose and fructose derivatives are good candidates for metabolite(s) that prompts Mondo/ChREBP in sensing glucose uptake by way of the polyol pathway. It has been proven that the focus of circulating fructose is acutely elevated upon glucose ingestion, most likely as a result of low basal focus of fructose within the hemolymph [38]. Subsequently, conversion of a portion of ingested glucose to fructose may very well be advantageous to permit glucose detection, particularly in hyperglycemic animals corresponding to bugs. Hyperglycemia can also be noticed within the mammalian liver to which dietary glucose is carried immediately from the small gut by means of the portal vein. We’ve proven that the polyol pathway is required for sensing glucose uptake within the mouse liver. The hepatic lobules are compartmentalized into areas with totally different metabolic features alongside the porto-central axis: glycolysis and lipogenesis happen within the hepatocytes near the central vein [39]. Sord mRNA is expressed with a peak within the pericentral hepatocytes [33], suggesting that the polyol pathway features in the identical area the place glycolysis and lipogenesis happen and contributes to matching the actions of glycolysis and lipogenesis with glucose provide. Then again, whether or not fructose is launched into the circulation and indicators to different cells within the liver and different organs awaits additional evaluation.

Insights into fructose-induced pathogenic mechanisms

The mannequin that fructose or fructose derivatives activate Mondo/ChREBP explains the helpful in addition to dangerous results of fructose. We’ve proven that the polyol pathway, i.e., the presence of fructose, decreases the glycemic responses to oral glucose consumption in mice (Fig 5Q and 5R). Constantly, it has been proven {that a} small quantity of fructose improves glucose tolerance in wholesome and adults with diabetes [4042]. Then again, it’s well-known that extreme fructose consumption, as represented by high-fructose corn syrup, has hostile results on human well being [4345]. It has been proposed that food-derived fructose is generally cleared within the small gut [46], and solely a really small quantity of fructose can be produced from glucose by means of the polyol pathway as glucose is a poor substrate for AR [35]. Subsequently, a direct influx of fructose to the liver attributable to extreme fructose ingestion might mislead the cells into responding as if there was very excessive quantity of glucose ingestion, inflicting them to overactivate metabolic responses to glucose ingestion by means of ChREBP. According to this, high-fructose ingestion in mice and rats is related to elevated ChREBP exercise within the liver [47,48]. Our work lays the muse for additional necessary research uncovering the molecular mechanisms linking irregular sugar metabolism and illness growth.

Supplies and strategies

Fry strains and dietary situations

The next fly shares had been used: Oregon-R (OR), white (w), y w, Cg-GAL4 (BDSC, RRID: BDSC_7011), actin-Gal4 (BDSC, RRID: BDSC_4414), UAS-Mondo RNAi (VDRC, v109821), UAS-Mondo, UAS-Mondo::HA (FlyORF, F000486) [49], and dilp2-GAL4>UAS-mCD8::GFP [50]. CG608410–1, CG1063810–1, sodh114–1, and sodh19–3 had been generated utilizing the CRISPR/Cas9 system (see under). Flies had been raised at 25°C on common fly meals containing (per liter) 40 g yeast extract, 50 g cornmeal, 30 g rice bran, 100 g glucose, and 6 g agar. Protein-rich meals was ready based on Havula and colleagues [5], with the next composition (per liter): 200 g yeast extract and 5 g agar.

Tracing experiments

Third instar larvae (96 hours AEL) had been transferred to a eating regimen containing 5% U-13C6-D-Glucose (Cambridge Isotope Laboratories), 1% Good Blue, and a pair of% agar. Good Blue was used to visually monitor meals ingestion. Larvae with uniform quantity of Good Blue of their midgut had been chosen for metabolomics evaluation to forestall any biases attributable to variations in feeding. Frozen samples in 1.5 ml plastic tubes had been homogenized in 300 μl chilly methanol with 1× ϕ3 mm zirconia beads utilizing a freeze crusher (TAITEC) at 41.6 Hz for two minutes. The homogenates had been blended with 200 μl methanol, 200 μl H2O, and 200 μl CHCl3 and vortexed for 20 minutes at room temperature. The samples had been centrifuged at 15,000 rpm (20,000 g) for quarter-hour at 4°C. The supernatant was blended with 350 μl H2O and vortexed for 10 minutes at room temperature. The samples had been centrifuged at 15,000 rpm for quarter-hour at 4°C, and the aqueous section was collected. The samples had been dried down in a vacuum concentrator, re-dissolved in 2 mM ammonium bicarbonate (pH 8.0), and analyzed by LC–MS/MS.

Chromatographic separation and mass spectrometric analyses had been carried out basically as described beforehand [55]. Chromatographic separation was carried out on an ACQUITY BEH Amide column (100 mm × 2.1 mm, 1.7 μm particles, Waters) together with a VanGuard precolumn (5 mm × 2.1 mm, 1.7 μm particles) utilizing an Acquity UPLC H-Class System (Waters). Elution was carried out at 30°C beneath isocratic situations (0.3 ml/minute, 70% acetonitrile, and 30% 10 mM ammonium bicarbonate (pH 10.0)). The mass spectrometric evaluation was carried out utilizing a Xevo TQD triple quadrupole mass spectrometer (Waters) coupled with an electrospray ionization supply within the damaging ion mode. The a number of response monitoring transitions had been as follows: m/z 179.1 to 89.0 for 12C6-fructose and -glucose, m/z 185.1 to 92.0 for 13C6-fructose and -glucose, m/z 181.1 to 89.0 for 12C6-sorbitol, and m/z 187.1 to 92.0 for 13C6-sorbitol.

Metabolic assays utilizing fuel chromatography–mass spectrometry

Third instar larvae (96 hours AEL) had been rinsed with water and dried on filter paper. The cuticle was torn by forceps to launch the hemolymph on a Parafilm membrane. The 1 μl of hemolymph was collected and instantly quenched by mixing with 300 μl of chilly methanol. The samples had been additional blended with 200 μl of methanol, 200 μl of H2O, and 200 μl of CHCl3 and vortexed for 20 minutes at room temperature. The samples had been centrifuged at 20,000 g for quarter-hour at 4°C. The supernatant was blended with 350 μl of H2O and vortexed for 10 minutes at room temperature. The samples had been centrifuged at 20,000 g for quarter-hour at 4°C. The aqueous section was collected and dried in a vacuum concentrator. Methoxyamine pyridine resolution [20 mg/ml methoxyamine hydrochloride (Wako) in pyridine] was added to the dried residue to re-dissolve and oximated for 90 minutes at 30°C. Then, MSTFA + 1percentTMCS (Thermo Fisher Scientific) was added and incubated for 60 minutes at 37°C for trimethylsilylation. The derivatized metabolites had been analyzed by an Agilent 7890B GC coupled to a 5977A Mass Selective Detector (Agilent Applied sciences) beneath the next situations: service fuel, helium; circulation price, 0.8 ml/minute; column, DB-5MS + DG (30 m × 0.25 mm, 0.25 μm movie thickness, Agilent Applied sciences); injection mode, 1:10 cut up; inlet temperature, 250°C; ion supply temperature, 230°C; quadrupole temperature, 150°C. The column temperature was held at 60°C for 1 minute, after which elevated to 325°C at a price of 10°C/minute. The detector was operated within the electron affect ionization mode. The Agilent-Fiehn GC/MS Metabolomics RTL Library was used for metabolite identification [55]. Metabolites had been detected in SIM mode and the height space of pursuits was analyzed by the QuantAnalysis software program (Agilent Applied sciences).

Immunofluorescence and picture evaluation of fats our bodies

To detect Mondo::Venus in cultured fats physique cells, fats our bodies had been mounted with 4% paraformaldehyde in PBS for half-hour and stained with rabbit anti-GFP polyclonal antibody (Thermo Fisher Scientific, 1:1,000) and Alexa Fluor 488-conjugated anti-rabbit-IgG (Thermo Fisher Scientific, 1:500). Nuclei and cortical actin had been labeled with DAPI (Thermo Fisher Scientific, 1 μg/mL) and Rhodamine-conjugated Phalloidin (Thermo Fisher Scientific, 1:100), respectively. After staining, fats our bodies had been mounted in VECTASHIELD Mounting Medium (Vector Laboratories) and imaged with TCS SP8 confocal microscope utilizing a Plan-Apochromat 63× oil-immersion goal lens (Leica Microsystems) or Fluoview FV1000 confocal microscope utilizing a UPlanSApo 60× water-immersion goal lens (Olympus). Pictures of the fats physique had been analyzed utilizing the ImageJ2 software program (model 2.0.0-rc-43, NIH). Cell and nucleus contours had been traced with the freehand instrument on the picture. Sign intensities inside every area had been measured, after which the share of nuclear Mondo was calculated. To detect glucose-dependent Mondo::Venus localization in starved fats physique cells, fats our bodies had been mounted with 4% paraformaldehyde in PBS for quarter-hour. Nuclei had been labeled with DAPI (Thermo Fisher Scientific, 1 μg/mL). Venus fluorescence and DAPI indicators had been detected with Biorevo BZ-9000 fluorescent microscope utilizing a Plan-Apochromat 40× lens (Keyence). Nucleus contour was traced utilizing a customized program written for the R software program atmosphere (www.r-project.org) with the EBImage bundle [56]. The customized program is out there from the next web site (https://github.com/yukatonig/fatbody). To detect Dilp2 in insulin-producing cells, larval brains containing the dilp2>mCD8::GFP reporter had been stained with rabbit anti-Dilp2 and mouse anti-GFP antibodies as described beforehand [23].

Technology of Sord knockout mouse

Sord knockout mouse was generated as described beforehand by introducing the Cas9 protein, tracrRNA, crRNA, and ssODN into C57BL/6N fertilized eggs [57]. For producing the Sord Δex3-9 allele, the artificial crRNA was designed to direct GAGACAAAGGAAACACGTGA(GGG) within the intron 2 and AATCACAGTAGAACACACAA(AGG) within the exon 9. ssODN: 5′-TTCTTCATAAGTCAGCCCCACTCTCTGGCAATCACAGTAGTTTATTTATTTATGAGGGAAAGGCGAACCTTCCATTGCTCTCAGAAGTGCTA was used as a template for homologous recombination. The genome of focused F0 mice was amplified by PCR utilizing the Sord 13357- and Sord -30158 primers. A 1,052-bp fragment was amplified from the genome of the Sord Δex3-9 allele. The PCR amplicons had been sequenced utilizing the Sord 13815- primer. F0 mice had been backcrossed with C57BL/6N to determine the Sord Δex3-9 line.

Sord 13357-: 5′-GCAGTCTCTGGCCAGTTTTC

Sord -30158: 5′-TTGCCTGTGAGTGACTCTGG

Sord 13815-: 5′-CGGTTTCCTTTGGAATCTCA

Sord KO mice had been maintained beneath a temperature- and humidity-controlled particular pathogen-free situations (22 ± 2°C, 50 ± 20%) on a 12-hour darkish/12-hour gentle cycle and had been allowed advert libitum entry to regular laboratory chow and water. Physique weight and meals consumption had been measured each week. The animal protocol was authorised by the Kurume College Institutional Animal Care and Use Committee (approval quantity: 2018–242, 2019–075, 2020–158, and 2021–209).

Supporting info

S1 Fig. Technology of the CG6084 mutant allele.

(A) CRISPR-mediated mutagenesis of the CG6084 gene. A sgRNA was designed for the sequence inside the exon widespread to the CG6084 isoforms. The genomic map was tailored from FlyBase (http://flybase.org). (B) Breakpoint of the CG608410-1 allele. The CG608410-1 mutation brought about a frameshift (yellow) resulting in a untimely termination in all isoforms of the CG6084 protein. The mutant proteins lack many of the catalytic area of the CG6084 protein (blue in schematic, underlined within the amino acid sequence).

https://doi.org/10.1371/journal.pbio.3001678.s001

(TIF)

S2 Fig. Technology of the CG10638 mutant allele.

(A) CRISPR-mediated mutagenesis of the CG10638 gene. A sgRNA was designed for the sequence inside the exon widespread to the CG10638 isoforms. The genomic map was tailored from FlyBase (http://flybase.org). (B) Breakpoint of the CG1063810-1 allele. The CG1063810-1 mutation brought about a frameshift (yellow) resulting in untimely termination of all isoforms of the CG10638 protein. The mutant proteins lack many of the catalytic area (blue in schematic, underlined within the amino acid sequence).

https://doi.org/10.1371/journal.pbio.3001678.s002

(TIF)

S7 Fig. Knockin of the Venus fluorescent protein within the Mondo locus.

(A) Schematic drawing of the Mondo locus (tailored from FlyBase, http://flybase.org). The Venus fluorescent protein was knocked-in on the C-terminus of the Mondo coding area (yellow). (B) Western blot utilizing fats physique extracts from the Mondo::Venus line. The Mondo::Venus fusion protein was detected with the anti-GFP polyclonal antibody. Unique uncropped western blot picture may be present in S1 Uncooked picture.

https://doi.org/10.1371/journal.pbio.3001678.s007

(TIF)

S2 Knowledge. Sugar-responsive Mondo/Mlx-target genes.

Earlier examine has reported sugar-dependent transcriptomes in wild-type and mutants of max-like protein X (mlx, also called bigmax), the obligated associate of Mondo [6]. To determine Mondo/Mlx-target genes, RNA-seq datasets reported in (GES70980) [6] had been analyzed utilizing the FlyBase reference genome (Dmel Launch 6.19). First, we chosen genes whose expression ranges had been considerably modified between management and mlx mutant larvae beneath excessive sugar situations. Of these, genes whose expression ranges had been considerably totally different between management and mlx mutants beneath low sugar situations had been eliminated. control_HSD = common expression ranges of triplicated experiments of HSD-fed management larvae (FPKM), mlx1_HSD = common expression ranges of triplicated experiments of HSD-fed mlx mutant larvae (FPKM), logFC = log2 fold-change, test_stat = take a look at statistics, p_value = uncorrected p-value of the take a look at statistics, q_value = adjusted p-value of the take a look at statistics with Benjamin–Hochberg correction.

https://doi.org/10.1371/journal.pbio.3001678.s011

(XLSX)

References

  1. 1.
    Towle HC. Glucose as a regulator of eukaryotic gene transcription. Tendencies Endocrinol Metab. 2005;16(10):489–94. Epub 2005/11/05. pmid:16269245.
  2. 2.
    Richards P, Ourabah S, Montagne J, Burnol AF, Postic C, Guilmeau S. MondoA/ChREBP: The standard suspects of transcriptional glucose sensing; Implication in pathophysiology. Metabolism. 2017;70:133–51. Epub 2017/04/14. pmid:28403938.
  3. 3.
    Iizuka Okay, Bruick RK, Liang G, Horton JD, Uyeda Okay. Deficiency of carbohydrate response element-binding protein (ChREBP) reduces lipogenesis in addition to glycolysis. Proc Natl Acad Sci U S A. 2004;101(19):7281–6. Epub 2004/05/01. pmid:15118080; PubMed Central PMCID: PMC409910.
  4. 4.
    Billin AN, Eilers AL, Coulter KL, Logan JS, Ayer DE. MondoA, a novel fundamental helix-loop-helix-leucine zipper transcriptional activator that constitutes a constructive department of a max-like community. Mol Cell Biol. 2000;20(23):8845–54. Epub 2000/11/14. pmid:11073985; PubMed Central PMCID: PMC86535.
  5. 5.
    Havula E, Teesalu M, Hyotylainen T, Seppala H, Hasygar Okay, Auvinen P, et al. Mondo/ChREBP-Mlx-regulated transcriptional community is crucial for dietary sugar tolerance in Drosophila. PLoS Genet. 2013;9(4):e1003438. Epub 2013/04/18. pmid:23593032; PubMed Central PMCID: PMC3616910.
  6. 6.
    Mattila J, Havula E, Suominen E, Teesalu M, Surakka I, Hynynen R, et al. Mondo-Mlx Mediates Organismal Sugar Sensing by means of the Gli-Related Transcription Issue Sugarbabe. Cell Rep. 2015;13(2):350–64. Epub 2015/10/07. pmid:26440885.
  7. 7.
    Davies MN, O’Callaghan BL, Towle HC. Glucose prompts ChREBP by growing its price of nuclear entry and relieving repression of its transcriptional exercise. J Biol Chem. 2008;283(35):24029–38. Epub 2008/07/02. pmid:18591247; PubMed Central PMCID: PMC2527113.
  8. 8.
    Kawaguchi T, Takenoshita M, Kabashima T, Uyeda Okay. Glucose and cAMP regulate the L-type pyruvate kinase gene by phosphorylation/dephosphorylation of the carbohydrate response ingredient binding protein. Proc Natl Acad Sci U S A. 2001;98(24):13710–5. Epub 2001/11/08. pmid:11698644; PubMed Central PMCID: PMC61106.
  9. 9.
    Davies MN, O’Callaghan BL, Towle HC. Activation and repression of glucose-stimulated ChREBP requires the concerted motion of a number of domains inside the MondoA conserved area. Am J Physiol Endocrinol Metab. 2010;299(4):E665–74. Epub 2010/08/05. pmid:20682844; PubMed Central PMCID: PMC2957870.
  10. 10.
    Li MV, Chang B, Imamura M, Poungvarin N, Chan L. Glucose-dependent transcriptional regulation by an evolutionarily conserved glucose-sensing module. Diabetes. 2006;55(5):1179–89. Epub 2006/04/29. pmid:16644671.
  11. 11.
    Arden C, Tudhope SJ, Petrie JL, Al-Oanzi ZH, Cullen KS, Lange AJ, et al. Fructose 2,6-bisphosphate is crucial for glucose-regulated gene transcription of glucose-6-phosphatase and different ChREBP goal genes in hepatocytes. Biochem J. 2012;443(1):111–23. Epub 2012/01/05. pmid:22214556.
  12. 12.
    Dentin R, Tomas-Cobos L, Foufelle F, Leopold J, Girard J, Postic C, et al. Glucose 6-phosphate, fairly than xylulose 5-phosphate, is required for the activation of ChREBP in response to glucose within the liver. J Hepatol. 2012;56(1):199–209. Epub 2011/08/13. pmid:21835137.
  13. 13.
    Diaz-Moralli S, Ramos-Montoya A, Marin S, Fernandez-Alvarez A, Casado M, Cascante M. Goal metabolomics revealed complementary roles of hexose- and pentose-phosphates within the regulation of carbohydrate-dependent gene expression. Am J Physiol Endocrinol Metab. 2012;303(2):E234–42. Epub 2012/05/10. pmid:22569070.
  14. 14.
    Iizuka Okay, Wu W, Horikawa Y, Takeda J. Function of glucose-6-phosphate and xylulose-5-phosphate within the regulation of glucose-stimulated gene expression within the pancreatic beta cell line, INS-1E. Endocr J. 2013;60(4):473–82. Epub 2012/12/22. pmid:23257733.
  15. 15.
    Li MV, Chen W, Harmancey RN, Nuotio-Antar AM, Imamura M, Saha P, et al. Glucose-6-phosphate mediates activation of the carbohydrate responsive binding protein (ChREBP). Biochem Biophys Res Commun. 2010;395(3):395–400. Epub 2010/04/13. pmid:20382127; PubMed Central PMCID: PMC2874883.
  16. 16.
    Peterson CW, Stoltzman CA, Sighinolfi MP, Han KS, Ayer DE. Glucose controls nuclear accumulation, promoter binding, and transcriptional exercise of the MondoA-Mlx heterodimer. Mol Cell Biol. 2010;30(12):2887–95. Epub 2010/04/14. pmid:20385767; PubMed Central PMCID: PMC2876681.
  17. 17.
    Petrie JL, Al-Oanzi ZH, Arden C, Tudhope SJ, Mann J, Kieswich J, et al. Glucose induces protein focusing on to glycogen in hepatocytes by fructose 2,6-bisphosphate-mediated recruitment of MondoA to the promoter. Mol Cell Biol. 2013;33(4):725–38. Epub 2012/12/05. pmid:23207906; PubMed Central PMCID: PMC3571345.
  18. 18.
    Stoltzman CA, Peterson CW, Breen KT, Muoio DM, Billin AN, Ayer DE. Glucose sensing by MondoA:Mlx complexes: a task for hexokinases and direct regulation of thioredoxin-interacting protein expression. Proc Natl Acad Sci U S A. 2008;105(19):6912–7. Epub 2008/05/07. pmid:18458340; PubMed Central PMCID: PMC2383952.
  19. 19.
    Kabashima T, Kawaguchi T, Wadzinski BE, Uyeda Okay. Xylulose 5-phosphate mediates glucose-induced lipogenesis by xylulose 5-phosphate-activated protein phosphatase in rat liver. Proc Natl Acad Sci U S A. 2003;100(9):5107–12. Epub 2003/04/10. pmid:12684532; PubMed Central PMCID: PMC154306.
  20. 20.
    Peeters Okay, Van Leemputte F, Fischer B, Bonini BM, Quezada H, Tsytlonok M, et al. Fructose-1,6-bisphosphate {couples} glycolytic flux to activation of Ras. Nat Commun. 2017;8(1):922. Epub 2017/10/17. pmid:29030545; PubMed Central PMCID: PMC5640605.
  21. 21.
    Berg JM, Tymoczko JL, Stryer L. The glycolytic pathway is tightly managed. Biochemistry. sixth ed. WHFreeman and Firm; 2006. p. 452–6.
  22. 22.
    Hers HG. The mechanism of the transformation of glucose in fructose within the seminal vesicles. Biochim Biophys Acta. 1956;22(1):202–3. Epub 1956/10/01. pmid:13373872.
  23. 23.
    Sano H, Nakamura A, Texada MJ, Truman JW, Ishimoto H, Kamikouchi A, et al. The Nutrient-Responsive Hormone CCHamide-2 Controls Progress by Regulating Insulin-like Peptides within the Mind of Drosophila melanogaster. PLoS Genet. 2015;11(5):e1005209. Epub 2015/05/29. pmid:26020940; PubMed Central PMCID: PMC4447355.
  24. 24.
    Sano H. Coupling of development to dietary standing: The position of novel periphery-to-brain signaling by the CCHa2 peptide in Drosophila melanogaster. Fly (Austin). 2015;9(4):183–7. Epub 2016/03/17. pmid:26980588; PubMed Central PMCID: PMC4862427.
  25. 25.
    Kanehisa M, Furumichi M, Sato Y, Ishiguro-Watanabe M, Tanabe M. KEGG: integrating viruses and mobile organisms. Nucleic Acids Res. 2021;49(D1):D545–D51. Epub 2020/10/31. pmid:33125081; PubMed Central PMCID: PMC7779016.
  26. 26.
    Kanehisa M, Goto S. KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000;28(1):27–30. Epub 1999/12/11. pmid:10592173; PubMed Central PMCID: PMC102409.
  27. 27.
    Kanehisa M. Towards understanding the origin and evolution of mobile organisms. Protein Sci. 2019. Epub 2019/08/24. pmid:31441146
  28. 28.
    Matsushita R, Nishimura T. Trehalose metabolism confers developmental robustness and stability in Drosophila by regulating glucose homeostasis. Commun Biol. 2020;3(1):170. Epub 2020/04/09. pmid:32265497; PubMed Central PMCID: PMC7138798.
  29. 29.
    Pasco MY, Leopold P. Excessive sugar-induced insulin resistance in Drosophila depends on the lipocalin Neural Lazarillo. PLoS ONE. 2012;7(5):e36583. Epub 2012/05/09. pmid:22567167; PubMed Central PMCID: PMC3342234.
  30. 30.
    Noordeen NA, Meur G, Rutter GA, Leclerc I. Glucose-induced nuclear shuttling of ChREBP is mediated by sorcin and Ca(2+) ions in pancreatic beta-cells. Diabetes. 2012;61(3):574–85. Epub 2012/02/18. pmid:22338092; PubMed Central PMCID: PMC3282809.
  31. 31.
    Sakiyama H, Wynn RM, Lee WR, Fukasawa M, Mizuguchi H, Gardner KH, et al. Regulation of nuclear import/export of carbohydrate response element-binding protein (ChREBP): interplay of an alpha-helix of ChREBP with the 14-3-3 proteins and regulation by phosphorylation. J Biol Chem. 2008;283(36):24899–908. Epub 2008/07/09. pmid:18606808; PubMed Central PMCID: PMC3259841.
  32. 32.
    LeCluyse EL, Witek RP, Andersen ME, Powers MJ. Organotypic liver tradition fashions: assembly present challenges in toxicity testing. Crit Rev Toxicol. 2012;42(6):501–48. Epub 2012/05/16. pmid:22582993; PubMed Central PMCID: PMC3423873.
  33. 33.
    Halpern KB, Shenhav R, Matcovitch-Natan O, Toth B, Lemze D, Golan M, et al. Single-cell spatial reconstruction reveals world division of labour within the mammalian liver. Nature. 2017;542(7641):352–6. Epub 2017/02/07. pmid:28166538; PubMed Central PMCID: PMC5321580.
  34. 34.
    Jois T, Chen W, Howard V, Harvey R, Youngs Okay, Thalmann C, et al. Deletion of hepatic carbohydrate response ingredient binding protein (ChREBP) impairs glucose homeostasis and hepatic insulin sensitivity in mice. Mol Metab. 2017;6(11):1381–94. Epub 2017/11/07. pmid:29107286; PubMed Central PMCID: PMC5681238.
  35. 35.
    Gabbay KH. The sorbitol pathway and the issues of diabetes. N Engl J Med. 1973;288(16):831–6. Epub 1973/04/19. pmid:4266466.
  36. 36.
    Mor I, Cheung EC, Vousden KH. Management of glycolysis by means of regulation of PFK1: previous associates and up to date additions. Chilly Spring Harb Symp Quant Biol. 2011;Epub 2011/11/19(76):211–6. pmid:22096029.
  37. 37.
    Matsuda H, Yamada T, Yoshida M, Nishimura T. Flies with out trehalose. J Biol Chem. 2015;290(2):1244–55. Epub 2014/12/03. pmid:25451929; PubMed Central PMCID: PMC4294489.
  38. 38.
    Miyamoto T, Slone J, Tune X, Amrein H. A fructose receptor features as a nutrient sensor within the Drosophila mind. Cell. 2012;151(5):1113–25. Epub 2012/11/28. pmid:23178127; PubMed Central PMCID: PMC3509419.
  39. 39.
    Kietzmann T. Metabolic zonation of the liver: The oxygen gradient revisited. Redox Biol. 2017;11:622–30. Epub 2017/01/28. pmid:28126520; PubMed Central PMCID: PMC5257182.
  40. 40.
    Crapo PA, Kolterman OG, Olefsky JM. Results of oral fructose in regular, diabetic, and impaired glucose tolerance topics. Diabetes Care. 1980;3(5):575–82. Epub 1980/09/01. pmid:7002511.
  41. 41.
    Moore MC, Cherrington AD, Mann SL, Davis SN. Acute fructose administration decreases the glycemic response to an oral glucose tolerance take a look at in regular adults. J Clin Endocrinol Metab. 2000;85(12):4515–9. Epub 2001/01/03. pmid:11134101.
  42. 42.
    Moore MC, Davis SN, Mann SL, Cherrington AD. Acute fructose administration improves oral glucose tolerance in adults with sort 2 diabetes. Diabetes Care. 2001;24(11):1882–7. Epub 2001/10/27. pmid:11679451.
  43. 43.
    Bray GA, Nielsen SJ, Popkin BM. Consumption of high-fructose corn syrup in drinks might play a task within the epidemic of weight problems. Am J Clin Nutr. 2004;79(4):537–43. Epub 2004/03/31. pmid:15051594.
  44. 44.
    Lim JS, Mietus-Snyder M, Valente A, Schwarz JM, Lustig RH. The position of fructose within the pathogenesis of NAFLD and the metabolic syndrome. Nat Rev Gastroenterol Hepatol. 2010;7(5):251–64. Epub 2010/04/07. pmid:20368739.
  45. 45.
    Marriott BP, Cole N, Lee E. Nationwide estimates of dietary fructose consumption elevated from 1977 to 2004 in the US. J Nutr. 2009;139(6):1228S–35S. Epub 2009/05/01. pmid:19403716.
  46. 46.
    Jang C, Hui S, Lu W, Cowan AJ, Morscher RJ, Lee G, et al. The Small Gut Converts Dietary Fructose into Glucose and Natural Acids. Cell Metab. 2018;27(2):351–61 e3. Epub 2018/02/08. pmid:29414685; PubMed Central PMCID: PMC6032988.
  47. 47.
    Kim MS, Krawczyk SA, Doridot L, Fowler AJ, Wang JX, Trauger SA, et al. ChREBP regulates fructose-induced glucose manufacturing independently of insulin signaling. J Clin Make investments. 2016;126(11):4372–86. Epub 2016/11/02. pmid:27669460; PubMed Central PMCID: PMC5096918.
  48. 48.
    Koo HY, Miyashita M, Cho BH, Nakamura MT. Changing dietary glucose with fructose will increase ChREBP exercise and SREBP-1 protein in rat liver nucleus. Biochem Biophys Res Commun. 2009;390(2):285–9. Epub 2009/10/06. pmid:19799862.
  49. 49.
    Bischof J, Bjorklund M, Furger E, Schertel C, Taipale J, Basler Okay. A flexible platform for making a complete UAS-ORFeome library in Drosophila. Improvement. 2013;140(11):2434–42. Epub 2013/05/03. pmid:23637332.
  50. 50.
    Rulifson EJ, Kim SK, Nusse R. Ablation of insulin-producing neurons in flies: development and diabetic phenotypes. Science. 2002;296(5570):1118–20. Epub 2002/05/11. pmid:12004130.
  51. 51.
    Gokcezade J, Sienski G, Duchek P. Environment friendly CRISPR/Cas9 plasmids for fast and versatile genome enhancing in Drosophila. G3 (Bethesda). 2014;4(11):2279–82. Epub 2014/09/23. pmid:25236734; PubMed Central PMCID: PMC4232553.
  52. 52.
    Kina H, Yoshitani T, Hanyu-Nakamura Okay, Nakamura A. Speedy and environment friendly technology of GFP-knocked-in Drosophila by the CRISPR-Cas9-mediated genome enhancing. Dev Progress Differ. 2019;61(4):265–75. Epub 2019/05/01. pmid:31037730.
  53. 53.
    Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL. TopHat2: correct alignment of transcriptomes within the presence of insertions, deletions and gene fusions. Genome Biol. 2013;14(4):R36. Epub 2013/04/27. pmid:23618408; PubMed Central PMCID: PMC4053844.
  54. 54.
    Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, et al. Transcript meeting and quantification by RNA-Seq reveals unannotated transcripts and isoform switching throughout cell differentiation. Nat Biotechnol. 2010;28(5):511–5. Epub 2010/05/04. pmid:20436464; PubMed Central PMCID: PMC3146043.
  55. 55.
    Form T, Wohlgemuth G, Lee DY, Lu Y, Palazoglu M, Shahbaz S, et al. FiehnLib: mass spectral and retention index libraries for metabolomics based mostly on quadrupole and time-of-flight fuel chromatography/mass spectrometry. Anal Chem. 2009;81(24):10038–48. Epub 2009/11/26. pmid:19928838; PubMed Central PMCID: PMC2805091.
  56. 56.
    Pau G, Fuchs F, Sklyar O, Boutros M, Huber W. EBImage—an R bundle for picture processing with functions to mobile phenotypes. Bioinformatics. 2010;26(7):979–81. Epub 2010/03/27. pmid:20338898; PubMed Central PMCID: PMC2844988.
  57. 57.
    Takemoto Okay, Tani N, Takada-Horisawa Y, Fujimura S, Tanno N, Yamane M, et al. Meiosis-Particular C19orf57/4930432K21Rik/BRME1 Modulates Localization of RAD51 and DMC1 to DSBs in Mouse Meiotic Recombination. Cell Rep. 2020;31(8):107686. Epub 2020/05/28. pmid:32460033.

[ad_2]

RELATED ARTICLES

LEAVE A REPLY

Please enter your comment!
Please enter your name here

Most Popular

Recent Comments